Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T48166 Target Info
Target Name High mobility group protein HMGI-C (HMGA2)
Synonyms High mobility group AThook protein 2; High mobility group AT-hook protein 2; HMGIC
Target Type Literature-reported Target
Gene Name HMGA2
UniProt ID
P52926
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7b-5p by siRNA transfection resulted in the decreased protein level of target HMGA2; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target HMGA2. [2]
Evidence Score (E-score) 5 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; qRT-PCR [4]
5 Microarray; qRT-PCR [5]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7c-5p by mature miRNA precursor transfection resulted in the decreased protein level of target HMGA2; The Underexpression by Anti-miRNA Oligonucleotides resulted in the increased protein level of target HMGA2. [2]
Evidence Score (E-score) 5 +
1 Immunocytochemistry; Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
2 Immunocytochemistry; Immunofluorescent Assay; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
4 Microarray; Northern Blot; qRT-PCR; Western Blot [8]
5 qRT-PCR; Western Blot; Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-let-7g-5p miRNA Info
miRNA Mature AC
MIMAT0000414
Sequence ugagguaguaguuuguacaguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7g-5p by mature miRNA precursor transfection resulted in the decreased protein level of target HMGA2; The Underexpression by Anti-miRNA Oligonucleotides resulted in the increased protein level of target HMGA2. [2]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay [10]
3 Luciferase Reporter Assay [2]
4 Luciferase Reporter Assay; Western Blot; qRT-PCR [9]
5 Western Blot; Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-let-7d-5p miRNA Info
miRNA Mature AC
MIMAT0000065
Sequence agagguaguagguugcauaguu
miRNA Species Homo sapiens
Regulation Mechanism Introduction of let-7d into HeyA8 or HepG2 cells resulted in reduction of HMGA2 protein expression. [13]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay [9]
3 qRT-PCR; ChIP; Luciferase Reporter Assay [12]
4 Western Blot [13]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Divalent metal transporter 1 (SLC11A2) Target Info
NRAM2_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-204-5p by mature miRNA transfection resulted in the changed mRNA level of target HMGA2. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [14]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-33b-5p miRNA Info
miRNA Mature AC
MIMAT0003301
Sequence gugcauugcuguugcauugc
miRNA Species Homo sapiens
Regulation Mechanism miR-33b directly binds to HMGA2 3'UTR to suppress its expression. [18]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [16]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [17]
3 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7e-5p by siRNA transfection resulted in the decreased protein level of target HMGA2; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target HMGA2. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [4]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot; Northern Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-185-5p by mature miRNA mimics tranfection resulted in the changed mRNA level of target HMGA2. [2]
Evidence Score (E-score) 2 +
1 Immunoblot; Microarray; qRT-PCR [19]
2 Immunoblot; Microarray; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-543 miRNA Info
miRNA Mature AC
MIMAT0004954
Sequence aaacauucgcggugcacuucuu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [20]
2 PAR-CLIP [21]
Representative Target(s) Regulated by This miRNA Focal adhesion kinase 1 (FAK) Target Info
FAK1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-98-5p by mature miRNA precursor transfection resulted in the decreased protein level of target HMGA2; The Underexpression by Anti-miRNA Oligonucleotides resulted in the increased protein level of target HMGA2. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [22]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-let-7a-5p miRNA Info
miRNA Mature AC
MIMAT0000062
Sequence ugagguaguagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target HMGA2; The Underexpression by Anti-miRNA Oligonucleotides resulted in the increased protein level of target HMGA2. [2]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
GTPase HRas (HRAS) Target Info
RASH_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism miR-107 suppresses the proliferation of hepatoma cells by targeting HMGA2 mRNA. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 functions as a tumor suppressor in ovarian cancer and directly targets HMGA2 oncoprotein. [25]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [25]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-15 potentially targets HMGA2. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [27]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [28]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
miRNA Mature ID hsa-miR-370-3p miRNA Info
miRNA Mature AC
MIMAT0000722
Sequence gccugcugggguggaaccuggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [29]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
miRNA Mature ID hsa-miR-490-3p miRNA Info
miRNA Mature AC
MIMAT0002806
Sequence caaccuggaggacuccaugcug
miRNA Species Homo sapiens
Regulation Mechanism miR-490-3p bound directly to HMGA2 mRNA 3'UTR and mediated a decrease in HMGA2 mRNA and protein expression. [30]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [30]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-495-3p miRNA Info
miRNA Mature AC
MIMAT0002817
Sequence aaacaaacauggugcacuucuu
miRNA Species Homo sapiens
Regulation Mechanism miR-495 acts as a tumor suppressor in gastric cancer by inhibiting cell migration and invasion, which may be associated with direct inhibition on HMGA2. [31]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [31]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
Forkhead box protein C1 (FOXC1) Target Info
FOXC1_HUMAN
miRNA Mature ID hsa-miR-1297 miRNA Info
miRNA Mature AC
MIMAT0005886
Sequence uucaaguaauucaggug
miRNA Species Homo sapiens
Regulation Mechanism High-mobility group AT-hook 2 (HMGA2) is the target of miR297. [32]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [32]
Representative Target(s) Regulated by This miRNA High mobility group protein HMG-I/Y (HMGA1) Target Info
HMGA1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-154-5p miRNA Info
miRNA Mature AC
MIMAT0000452
Sequence uagguuauccguguugccuucg
miRNA Species Homo sapiens
Regulation Mechanism HMGA2 is a direct target gene of miR-154 by dual-luciferase reporter assay and miR-154 suppresses HMGA2 expression by binding to the HMGA2 3'UTR. [33]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [33]
Representative Target(s) Regulated by This miRNA High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
Toll-like receptor 2 (TLR2) Target Info
TLR2_HUMAN
miRNA Mature ID hsa-miR-33b-3p miRNA Info
miRNA Mature AC
MIMAT0004811
Sequence cagugccucggcagugcagccc
miRNA Species Homo sapiens
Regulation Mechanism HMGA2 is bona fide downstream target of miR-33b. [34]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-485-5p miRNA Info
miRNA Mature AC
MIMAT0002175
Sequence agaggcuggccgugaugaauuc
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity of wild-type 3'UTR of HMGA2 was significantly decreased by transfection with the miR-485-5p mimic. [35]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [35]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Frizzled-7 receptor (FZD7) Target Info
FZD7_HUMAN
miRNA Mature ID hsa-miR-633 miRNA Info
miRNA Mature AC
MIMAT0003303
Sequence cuaauaguaucuaccacaauaaa
miRNA Species Homo sapiens
Regulation Mechanism miR-663a inhibits HCC cell proliferation and motility by targeting HMGA2. [36]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [36]
Representative Target(s) Regulated by This miRNA High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
Transforming growth factor beta 1 (TGFB1) Target Info
TGFB1_HUMAN
References  Top
REF 1 Lin28b promotes head and neck cancer progression via modulation of the insulin-like growth factor survival pathway. Oncotarget. 2012 Dec;3(12):1641-52.
REF 2 High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5.
REF 3 Stat3-coordinated Lin-28-let-7-HMGA2 and miR-200-ZEB1 circuits initiate and maintain oncostatin M-driven epithelial-mesenchymal transition. Oncogene. 2013 Nov 7;32(45):5272-82.
REF 4 The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. Genes Dev. 2007 May 1;21(9):1025-30.
REF 5 Rapid and Efficient Direct Conversion of Human Adult Somatic Cells into Neural Stem Cells by HMGA2/let-7b. Cell Rep. 2015 Jan 20;10(3):441-452.
REF 6 HMGA2 overexpression-induced ovarian surface epithelial transformation is mediated through regulation of EMT genes. Cancer Res. 2011 Jan 15;71(2):349-59.
REF 7 Antiproliferative effects by Let-7 repression of high-mobility group A2 in uterine leiomyoma. Mol Cancer Res. 2008 Apr;6(4):663-73.
REF 8 A micro-RNA signature associated with race, tumor size, and target gene activity in human uterine leiomyomas. Genes Chromosomes Cancer. 2007 Apr;46(4):336-47.
REF 9 Let-7 expression defines two differentiation stages of cancer. Proc Natl Acad Sci U S A. 2007 Jul 3;104(27):11400-5.
REF 10 Suppression of non-small cell lung tumor development by the let-7 microRNA family. Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3903-8.
REF 11 Identification of let-7-regulated oncofetal genes. Cancer Res. 2008 Apr 15;68(8):2587-91.
REF 12 Inhibition and role of let-7d in idiopathic pulmonary fibrosis. Am J Respir Crit Care Med. 2010 Jul 15;182(2):220-9.
REF 13 Let-7 prevents early cancer progression by suppressing expression of the embryonic gene HMGA2. Cell Cycle. 2007 Nov 1;6(21):2585-90.
REF 14 MicroRNA-204 modulates colorectal cancer cell sensitivity in response to 5-fluorouracil-based treatment by targeting high mobility group protein A2. Biol Open. 2016 May 15;5(5):563-70.
REF 15 MiR-204 regulates HMGA2 expression and inhibits cell proliferation in human thyroid cancer. Cancer Biomark. 2015;15(5):535-42.
REF 16 SREBP-1c/MicroRNA 33b Genomic Loci Control Adipocyte Differentiation. Mol Cell Biol. 2016 Feb 1;36(7):1180-93.
REF 17 MiR-33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression. J Drug Target. 2017 Aug;25(7):653-660.
REF 18 Cordycepin (3'-deoxyadenosine) suppressed HMGA2, Twist1 and ZEB1-dependent melanoma invasion and metastasis by targeting miR-33b. Oncotarget. 2015;6(12):9834-53.
REF 19 MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677.
REF 20 MicroRNA-543 suppresses colorectal cancer growth and metastasis by targeting KRAS, MTA1 and HMGA2. Oncotarget. 2016 Apr 19;7(16):21825-39.
REF 21 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 22 Overexpression of RKIP inhibits cell invasion in glioma cell lines through upregulation of miR-98. Biomed Res Int. 2013;2013:695179.
REF 23 miR-106a-5p Suppresses the Proliferation, Migration, and Invasion of Osteosarcoma Cells by Targeting HMGA2. DNA Cell Biol. 2016 Sep;35(9):506-20.
REF 24 Biochem Biophys Res Commun. 2016 Nov 18;480(3):455-460.
REF 25 miR-145, targeting high-mobility group A2, is a powerful predictor of patient outcome in ovarian carcinoma. Cancer Lett. 2015 Jan 28;356(2 Pt B):937-45.
REF 26 Downregulation of HMGA-targeting microRNAs has a critical role in human pituitary tumorigenesis. Oncogene. 2012 Aug 23;31(34):3857-65.
REF 27 Mir-23b and miR-130b expression is downregulated in pituitary adenomas. Mol Cell Endocrinol. 2014 Jun 5;390(1-2):1-7.
REF 28 MicroRNA-33a mediates the regulation of high mobility group AT-hook 2 gene (HMGA2) by thyroid transcription factor 1 (TTF-1/NKX2-1). J Biol Chem. 2013 Jun 7;288(23):16348-60.
REF 29 HMGA2 maintains oncogenic RAS-induced epithelial-mesenchymal transition in human pancreatic cancer cells. Am J Pathol. 2009 Mar;174(3):854-68.
REF 30 MicroRNA-490-3p regulates cell proliferation and apoptosis by targeting HMGA2 in osteosarcoma. FEBS Lett. 2015 Oct 7;589(20 Pt B):3148-53.
REF 31 MicroRNA-495 Inhibits Gastric Cancer Cell Migration and Invasion Possibly via Targeting High Mobility Group AT-Hook 2 (HMGA2). Med Sci Monit. 2017 Feb 4;23:640-648.
REF 32 MiR-1297 promotes apoptosis and inhibits the proliferation and invasion of hepatocellular carcinoma cells by targeting HMGA2. Int J Mol Med. 2015 Nov;36(5):1345-52.
REF 33 miR-154 inhibits EMT by targeting HMGA2 in prostate cancer cells. Mol Cell Biochem. 2013 Jul;379(1-2):69-75.
REF 34 MicroRNA-33b Inhibits Breast Cancer Metastasis by Targeting HMGA2, SALL4 and Twist1. Sci Rep. 2015 Apr 28;5:9995.
REF 35 miR 85 p inhibits bladder cancer metastasis by targeting HMGA2. Int J Mol Med. 2015 Oct;36(4):1136-42.
REF 36 miR-663a inhibits hepatocellular carcinoma cell proliferation and invasion by targeting HMGA2. Biomed Pharmacother. 2016 Jul;81:431-438.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.