Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T97196 Target Info
Target Name ATM serine/threonine kinase (ATM)
Synonyms Serine-protein kinase ATM; Ataxia telangiectasia mutated; A-T mutated
Target Type Clinical trial Target
Gene Name ATM
Biochemical Class Kinase
UniProt ID
Q13315
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Regulation Mechanism miR-18a suppresses ATM expression by targeting 3'UTR of ATM. [5]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Sequencing [5]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
2 PAR-CLIP [7]
3 qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-421 miRNA Info
miRNA Mature AC
MIMAT0003339
Sequence aucaacagacauuaauugggcgc
miRNA Species Homo sapiens
Regulation Mechanism A significant reduction in the luciferase activity of the reporter construct containing the ATM 3`UTR was observed in the presence of miR-421. [10]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [9]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
3 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-374a-5p miRNA Info
miRNA Mature AC
MIMAT0000727
Sequence uuauaauacaaccugauaagug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [11]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [8]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-100 is mainly responsible for the low-expression of ATM in M059J cells. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-101-3p miRNA Info
miRNA Mature AC
MIMAT0000099
Sequence uacaguacugugauaacugaa
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Inhibiting miR-106a expression resulted in a significant increase of ATM expression and overexpression of miR-106a reduced ATM expression. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism miR-223 overexpression downregulates ATM expression and sensitizes U87 cells to radiation in vitro and in vivo. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-101-5p miRNA Info
miRNA Mature AC
MIMAT0004513
Sequence caguuaucacagugcugaugcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
DNA-dependent protein kinase catalytic (PRKDC) Target Info
PRKDC_HUMAN
miRNA Mature ID hsa-miR-18a-3p miRNA Info
miRNA Mature AC
MIMAT0002891
Sequence acugcccuaagugcuccuucugg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-18a downregulated the ATM and reduced DNA repair, while inhibition of miR-18a led to an increase of DNA damage repair by upregulated ATM. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Chromobox protein homolog 7 (CBX7) Target Info
CBX7_HUMAN
References  Top
REF 1 MicroRNA-18a attenuates DNA damage repair through suppressing the expression of ataxia telangiectasia mutated in colorectal cancer. PLoS One. 2013;8(2):e57036.
REF 2 Estrogen receptor regulates ATM Expression through miRNAs in breast cancer. Clin Cancer Res. 2013 Sep 15;19(18):4994-5002.
REF 3 The mTOR pathway negatively controls ATM by up-regulating miRNAs. Proc Natl Acad Sci U S A. 2013 Jul 16;110(29):11869-74.
REF 4 miR-18a impairs DNA damage response through downregulation of ataxia telangiectasia mutated (ATM) kinase. PLoS One. 2011;6(9):e25454.
REF 5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6 MiR-203 inhibits tumor invasion and metastasis in gastric cancer by ATM. Acta Biochim Biophys Sin (Shanghai). 2016 Aug;48(8):696-703.
REF 7 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
REF 8 miR-203 induces oxaliplatin resistance in colorectal cancer cells by negatively regulating ATM kinase. Mol Oncol. 2014 Feb;8(1):83-92.
REF 9 Aberrant overexpression of miR-421 downregulates ATM and leads to a pronounced DSB repair defect and clinical hypersensitivity in SKX squamous cell carcinoma. Radiother Oncol. 2013 Jan;106(1):147-54.
REF 10 ATM is down-regulated by N-Myc-regulated microRNA-421. Proc Natl Acad Sci U S A. 2010 Jan 26;107(4):1506-11.
REF 11 Phospho-Np63 is a key regulator of the cisplatin-induced microRNAome in cancer cells. Cell Death Differ. 2011 Jul;18(7):1220-30.
REF 12 Over-expression of miR-100 is responsible for the low-expression of ATM in the human glioma cell line: M059J. DNA Repair (Amst). 2010 Nov 10;9(11):1170-5.
REF 13 MicroRNA-223 enhances radiation sensitivity of U87MG cells in vitro and in vivo by targeting ataxia telangiectasia mutated. Int J Radiat Oncol Biol Phys. 2014 Mar 15;88(4):955-60.
REF 14 MicroRNA-18a enhances the radiosensitivity of cervical cancer cells by promoting radiation-induced apoptosis. Oncol Rep. 2015 Jun;33(6):2853-62.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.