Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T97257 Target Info
Target Name Transforming growth factor beta 1 (TGFB1)
Synonyms Transforming growth factor beta-1 proprotein; Transforming growth factor beta-1; TGFB; TGF-beta1; TGF-beta 1
Target Type Successful Target
Gene Name TGFB1
Biochemical Class Growth factor
UniProt ID
P01137
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR [3]
2 RT-PCR [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism Reduced miR-130a is involved in ITP via targeting of TGFB1 and IL18 expression. [5]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay [5]
2 RT-PCR? [6]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism miR-744 directly targets the predominant, short, isoform of the TGFB1 3'UTR, and are suggestive that reduced miR-744 expression may be associated with increased TGFB1 synthesis. [8]
Evidence Score (E-score) 2 +
1 Immunohistochemical Analysis [7]
2 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The level of TGF-B1 secreted into the cell culture supernatants were significantly down-regulated by miR-21 mimic and up-regulated by miR-21-inhibitor. [10]
Evidence Score (E-score) 2 +
1 ELISA; qRT-PCR [9]
2 Microarray [10]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-663a miRNA Info
miRNA Mature AC
MIMAT0003326
Sequence aggcggggcgccgcgggaccgc
miRNA Species Homo sapiens
Regulation Mechanism TGFB1 is a direct target of miR-663. [12]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
2 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Knockdown of miR-146a expression enhanced the expression of TGFB1 Mrna E while TGFB1 RNA and protein expression were reduced after overexpression of miR-146a. [13]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [15]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [16]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism TGFbRII reporter activity was repressed in both SAS and Fadu cells with increased miR-211 expression. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
miRNA Mature ID hsa-miR-29b-1-5p miRNA Info
miRNA Mature AC
MIMAT0004514
Sequence gcugguuucauauggugguuuaga
miRNA Species Homo sapiens
Regulation Mechanism miR-29b suppressed TGFB1 expression and miR-29b inhibited LX-2 activation mediated by TGFB1. [18]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [18]
Representative Target(s) Regulated by This miRNA Janus kinase 3 (JAK-3) Target Info
JAK3_HUMAN
Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
miRNA Mature ID hsa-miR-324-3p miRNA Info
miRNA Mature AC
MIMAT0000762
Sequence cccacugccccaggugcugcugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [19]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
CREB-binding protein (CREBBP) Target Info
CBP_HUMAN
miRNA Mature ID hsa-miR-422a miRNA Info
miRNA Mature AC
MIMAT0001339
Sequence acuggacuuagggucagaaggc
miRNA Species Homo sapiens
Regulation Mechanism miR-422a regulates TGFB2 expression at transcriptional and translational levels by directly targeting its 3'UTR. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Ecto-5'-nucleotidase (CD73) Target Info
5NTD_HUMAN
Forkhead box protein Q1 (FOXQ1) Target Info
FOXQ1_HUMAN
miRNA Mature ID hsa-miR-574-3p miRNA Info
miRNA Mature AC
MIMAT0003239
Sequence cacgcucaugcacacacccaca
miRNA Species Homo sapiens
Regulation Mechanism miR-574-3p inhibition was effective in eliminating the inhibition of AGS cell proliferation induced by TGFB1. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [21]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Histone acetyltransferase p300 (EP300) Target Info
EP300_HUMAN
miRNA Mature ID hsa-miR-590-5p miRNA Info
miRNA Mature AC
MIMAT0003258
Sequence gagcuuauucauaaaagugcag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [22]
Representative Target(s) Regulated by This miRNA Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
Lectin-like oxidized LDL receptor (OLR1) Target Info
OLR1_HUMAN
miRNA Mature ID hsa-miR-675-5p miRNA Info
miRNA Mature AC
MIMAT0004284
Sequence uggugcggagagggcccacagug
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-675 resulted in decreased protein level of TGFB1. [23]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA G-protein coupled receptor 55 (GPR55) Target Info
GPR55_HUMAN
Histone deacetylase 4 (HDAC4) Target Info
HDAC4_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [19]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-633 miRNA Info
miRNA Mature AC
MIMAT0003303
Sequence cuaauaguaucuaccacaauaaa
miRNA Species Homo sapiens
Regulation Mechanism miR-663 targets TGFb1 transcripts. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [24]
Representative Target(s) Regulated by This miRNA High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
Transforming growth factor beta 1 (TGFB1) Target Info
TGFB1_HUMAN
References  Top
REF 1 The Effects and Molecular Mechanisms of MiR-106a in Multidrug Resistance Reversal in Human Glioma U87/DDP and U251/G Cell Lines. PLoS One. 2015 May 7;10(5):e0125473.
REF 2 Ketamine Inhalation Ameliorates Ovalbumin-Induced Murine Asthma by Suppressing the Epithelial-Mesenchymal Transition. Med Sci Monit. 2016 Jul 15;22:2471-83.
REF 3 microRNA-122 down-regulation may play a role in severe myocardial fibrosis in human aortic stenosis through TGF-1 up-regulation. Clin Sci (Lond). 2014 Apr;126(7):497-506.
REF 4 Identification of a novel TGF-beta-miR-122-fibronectin 1/serum response factor signaling cascade and its implication in hepatic fibrogenesis. Oncotarget. 2015 May 20;6(14):12224-33.
REF 5 Reduced MIR130A is involved in primary immune thrombocytopenia via targeting TGFB1 and IL18. Br J Haematol. 2014 Sep;166(5):767-73.
REF 6 MicroRNA-130a-mediated down-regulation of Smad4 contributes to reduced sensitivity to TGF-beta1 stimulation in granulocytic precursors. Blood. 2011 Dec 15;118(25):6649-59.
REF 7 miR-144 regulates transforming growth factor-beta1 iduced hepatic stellate cell activation in human fibrotic liver. Int J Clin Exp Pathol. 2015 Apr 1;8(4):3994-4000.
REF 8 Post-transcriptional regulation of Transforming Growth Factor Beta-1 by microRNA-744. PLoS One. 2011;6(10):e25044.
REF 9 MicroRNA-21 negatively regulates Treg cells through a TGF-1/Smad-independent pathway in patients with coronary heart disease. Cell Physiol Biochem. 2015;37(3):866-78.
REF 10 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
REF 11 Inhibition of S-Adenosylmethionine-Dependent Methyltransferase Attenuates TGF1-Induced EMT and Metastasis in Pancreatic Cancer: Putative Roles of miR-663a and miR-4787-5p. Mol Cancer Res. 2016 Nov;14(11):1124-1135.
REF 12 MicroRNA-663 targets TGFB1 and regulates lung cancer proliferation. Asian Pac J Cancer Prev. 2011;12(11):2819-23.
REF 13 LPS induces HUVEC angiogenesis in vitro through miR-146a-mediated TGF-1 inhibition. Am J Transl Res. 2017 Feb 15;9(2):591-600.
REF 14 High expression of miR-15b predicts poor prognosis for hepatocellular carcinoma after curative hepatectomy. Oncol Rep. 2016 Oct;36(4):1901-8.
REF 15 Placental expression of microRNA-17 and -19b is down-regulated in early pregnancy loss. Eur J Obstet Gynecol Reprod Biol. 2013 Jul;169(1):28-32.
REF 16 MicroRNA 85 regulates transforming growth factor and collagen in hypertrophic scar fibroblasts. Mol Med Rep. 2017 Apr;15(4):1489-1496.
REF 17 miR-211 promotes the progression of head and neck carcinomas by targeting TGFRII. Cancer Lett. 2013 Aug 28;337(1):115-24.
REF 18 Suppressive effect of microRNA-29b on hepatic stellate cell activation and its crosstalk with TGF-1/Smad3. Cell Biochem Funct. 2016 Jul;34(5):326-33.
REF 19 Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.
REF 20 Overexpression of miR-422a inhibits cell proliferation and invasion, and enhances chemosensitivity in osteosarcoma cells. Oncol Rep. 2016 Dec;36(6):3371-3378.
REF 21 Upregulation of microRNA-574-3p in a human gastric cancer cell line AGS by TGF-1. Gene. 2017 Mar 20;605:63-69.
REF 22 miRNA expression profile of vulvar squamous cell carcinoma and identification of the oncogenic role of miR-590-5p. Oncol Rep. 2016 Jan;35(1):398-408.
REF 23 Long Noncoding RNA H19 Promotes Osteoblast Differentiation Via TGF-1/Smad3/HDAC Signaling Pathway by Deriving miR-675. Stem Cells. 2015 Dec;33(12):3481-92.
REF 24 Resveratrol modulates the levels of microRNAs targeting genes encoding tumor-suppressors and effectors of TGF signaling pathway in SW480 cells. Biochem Pharmacol. 2010 Dec 15;80(12):2057-65.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.