Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T54156 Target Info
Target Name Matrix metalloproteinase-9 (MMP-9)
Synonyms Matrix metalloproteinase 9; GELB; CLG4B; 92 kDa type IV collagenase; 92 kDa gelatinase
Target Type Clinical trial Target
Gene Name MMP9
Biochemical Class Peptidase
UniProt ID
P14780
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-491-5p miRNA Info
miRNA Mature AC
MIMAT0002807
Sequence aguggggaacccuuccaugagg
miRNA Species Homo sapiens
Regulation Mechanism miR-491-5p suppressed glioma cell invasion via targeting MMP-9 directly. [3]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Microarray; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism miR-132 targets 3 'UTR of MMP-9 mRNA and regulates the level of MMP-9 protein in neurons. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [4]
2 qRT-PCR [5]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism Intervention with miR-143mimic, the mRNA and protein expression levels of MMP-9 was decreased significantly. [7]
Evidence Score (E-score) 2 +
1 qRT-PCR [6]
2 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-204-5p by mature miRNA transfection resulted in the changed mRNA level of target MMP9. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [8]
2 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR [9]
2 Western Blot; qRT-PCR [10]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
MIMAT0000763
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Western Blot [11]
2 Western Blot; qRT-PCR [12]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism MMP9 is a direct target of miRNA let-7e. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-203a-5p miRNA Info
miRNA Mature AC
MIMAT0031890
Sequence agugguucuuaacaguucaacaguu
miRNA Species Homo sapiens
Regulation Mechanism miR203 inhibits matrix metalloproteinase 2. [16]
Evidence Score (E-score) 1 +
1 qRT-PCR [16]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism Suppression of MMP-9 and overexpression of miR-211 in 4910 and U87 cells were comparable and elicited similar anti-proliferative and apoptotic signaling mechanisms. [17]
Evidence Score (E-score) 1 +
1 Immunoblot; Immunohistochemistry [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-524-5p miRNA Info
miRNA Mature AC
MIMAT0002849
Sequence cuacaaagggaagcacuuucuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [19]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dual specificity protein kinase TTK (MPS1) Target Info
TTK_HUMAN
miRNA Mature ID hsa-miR-892b miRNA Info
miRNA Mature AC
MIMAT0004918
Sequence cacuggcuccuuucuggguaga
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-892b resulted in a reduction in MMP-9 expression. [20]
Evidence Score (E-score) 1 +
1 Immunoblot [20]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-302a-5p miRNA Info
miRNA Mature AC
MIMAT0000683
Sequence acuuaaacguggauguacuugcu
miRNA Species Homo sapiens
Regulation Mechanism Expressions and secretions of MMP-2 were evidently reduced by increasing miR-302a. [21]
Evidence Score (E-score) 1 +
1 ELISA; Western Blot [21]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Target Info
MMP2_HUMAN
Matrix metalloproteinase-9 (MMP-9) Target Info
MMP9_HUMAN
miRNA Mature ID hsa-miR-942-3p miRNA Info
miRNA Mature AC
MIMAT0026734
Sequence cacauggccgaaacagagaagu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-942 resulted in the increased mRNA levels of MMP-9. [22]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-9 (MMP-9) Target Info
MMP9_HUMAN
Vascular endothelial growth factor A (VEGFA) Target Info
VEGFA_HUMAN
References  Top
REF 1 MicroRNA-491 is involved in metastasis of hepatocellular carcinoma by inhibitions of matrix metalloproteinase and epithelial to mesenchymal transition. Liver Int. 2013 Sep;33(8):1271-80.
REF 2 A Single Nucleotide Polymorphism (rs1056629) in 3'-UTR of MMP-9 is Responsible for a Decreased Risk of Metastatic Osteosarcoma by Compromising its Interaction with microRNA-491-5p. Cell Physiol Biochem. 2016;38(4):1415-24.
REF 3 Identification of MMP-9 specific microRNA expression profile as potential targets of anti-invasion therapy in glioblastoma multiforme. Brain Res. 2011 Sep 9;1411:108-15.
REF 4 miR-132 Regulates Dendritic Spine Structure by Direct Targeting of Matrix Metalloproteinase 9 mRNA. Mol Neurobiol. 2016 Sep;53(7):4701-12.
REF 5 The Stress-Responding miR-132-3p Shows Evolutionarily Conserved Pathway Interactions. Cell Mol Neurobiol. 2018 Jan;38(1):141-153.
REF 6 Restoration of miR-143 expression could inhibit migration and growth of MDA-MB-468 cells through down-regulating the expression of invasion-related... Biomed Pharmacother. 2017 Jul;91:920-924.
REF 7 miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47.
REF 8 miR-204-5p acts as a tumor suppressor by targeting matrix metalloproteinases-9 and B-cell lymphoma-2 in malignant melanoma. Onco Targets Ther. 2017 Feb 27;10:1237-1246.
REF 9 MicroRNA-21 modulates biological functions of pancreatic cancer cells including their proliferation, invasion, and chemoresistance. Mol Cancer Ther. 2009 May;8(5):1067-74.
REF 10 MicroRNA-21 in pancreatic cancer: correlation with clinical outcome and pharmacologic aspects underlying its role in the modulation of gemcitabine ... Cancer Res. 2010 Jun 1;70(11):4528-38.
REF 11 Role of microRNA-mediated MMP regulation in the treatment and diagnosis of malignant tumors. Cancer Biol Ther. 2013 Sep;14(9):796-805.
REF 12 miR-338-3p suppresses invasion of liver cancer cell by targeting smoothened. J Pathol. 2011 Nov;225(3):463-72.
REF 13 miRNA let-7e targeting MMP9 is involved in adipose-derived stem cell differentiation toward epithelia. Cell Death Dis. 2014 Feb 6;5:e1048.
REF 14 microRNA-133b downregulation and inhibition of cell proliferation, migration and invasion by targeting matrix metallopeptidase-9 in renal cell carcinoma. Mol Med Rep. 2014 Jun;9(6):2491-8.
REF 15 Mangiferin regulates proliferation and apoptosis in glioma cells by induction of microRNA-15b and inhibition of MMP-9 expression. Oncol Rep. 2015 Jun;33(6):2815-20.
REF 16 MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42.
REF 17 Epigenetic regulation of miRNA-211 by MMP-9 governs glioma cell apoptosis, chemosensitivity and radiosensitivity. Oncotarget. 2012 Nov;3(11):1439-54.
REF 18 MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21.
REF 19 MicroRNA-524-5p suppresses the growth and invasive abilities of gastric cancer cells. Oncol Lett. 2016 Mar;11(3):1926-1932.
REF 20 MicroRNA-892b influences proliferation, migration and invasion of bladder cancer cells by mediating the p19ARF/cyclin D1/CDK6 and Sp-1/MMP-9 pathways. Oncol Rep. 2016 Oct;36(4):2313-20.
REF 21 Up-regulation of microRNA-302a inhibited the proliferation and invasion of colorectal cancer cells by regulation of the MAPK and PI3K/Akt signaling... Int J Clin Exp Pathol. 2015 May 1;8(5):4481-91.
REF 22 Identification of tissue microRNAs predictive of sunitinib activity in patients with metastatic renal cell carcinoma. PLoS One. 2014 Jan 24;9(1):e86263.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.