The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-200b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaauacugccugguaaugauga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
CREB1 is a target gene of miR-200b. |
[3] |
Evidence Score (E-score) |
3 |
+ |
1 |
Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[2] |
3 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
CDK inhibitor 1B p27Kip1 (CDKN1B)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-122-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggagugugacaaugguguuug
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[4] |
2 |
Microarray |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[6] |
2 |
qRT-PCR |
[7] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-182-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuuggcaaugguagaacucacacu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-182 directly targets the CREB1 3'UTR in gastric adenocarcinoma cells. |
[8] |
Evidence Score (E-score) |
2 |
+ |
1 |
GFP Reporter Assay |
[8] |
2 |
Western Blot |
[9] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-27b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucacaguggcuaaguucugc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
CREB1 was identified as a direct target of miR-27b, and downregulated by miR-27b. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[10] |
Representative Target(s) Regulated by This miRNA |
Adenosine A2b receptor (ADORA2B)
|
Target Info
|
|
Albendazole monooxygenase (CYP3A4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaucacuaacuccacugccau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Microarray; qRT-PCR; Western Blot |
[11] |
2 |
Microarray; qRT-PCR; Western Blot |
[12] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaggcagugucauuagcugauug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-34b-5p resulted in the decreased protein level of target CREB1. |
[12] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[13] |
2 |
Luciferase Reporter Assay |
[12] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Beta-catenin (CTNNB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-433-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aucaugaugggcuccucggugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
CREB1 is a direct target of miR-433. |
[14] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[14] |
2 |
Western Blot |
[15] |
Representative Target(s) Regulated by This miRNA |
cAMP-dependent chloride channel (CFTR)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-103a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agcagcauuguacagggcuauga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[12] |
2 |
qRT-PCR |
[16] |
Representative Target(s) Regulated by This miRNA |
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
Cyclin-dependent kinase 2 (CDK2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-10b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uacccuguagaaccgaauuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-10b-5p suppresses the expression of CREB1 by targeting the binding site in the 3'UTR. |
[17] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[17] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-150-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucucccaacccuuguaccagug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-150 suppressed CREB signaling by directly targeting CREB1. |
[18] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[18] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Beta-arrestin-2 (ARRB2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-203a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugaaauguuuaggaccacuag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Direct regulation of miR203 on the CREB1 3'UTR. |
[19] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[19] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucccuuugucauccuaugccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
CREB1 is a target of miR-204-5p. |
[20] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[20] |
Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-33b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugcauugcuguugcauugc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-33b binds to the 3'UTR of CREB1 and miR-33b repressed CREB1 3'UTR activities. |
[21] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[21] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-363-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aauugcacgguauccaucugua
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-363-3p suppresses the expression of CREB1 by targeting the binding site in the 3'UTR. |
[17] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[17] |
Representative Target(s) Regulated by This miRNA |
Caspase-3 (CASP3)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-582-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuacaguuguucaaccaguuacu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-582-5p targeted CREB-NF-kB signaling and caused opioid-induced immunosuppression in human monocytes. |
[22] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[22] |
Representative Target(s) Regulated by This miRNA |
Caspase-3 (CASP3)
|
Target Info
|
|
Caspase-9 (CASP9)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-1224-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccccaccuccucucuccucag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunofluorescence |
[23] |
Representative Target(s) Regulated by This miRNA |
ADAM metallopeptidase with thrombospondin 1 (ADAMTS1)
|
Target Info
|
|
Apoptosis signal-regulating kinase 1 (MAP3K5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-1224-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugaggacucgggaggugg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
CREB1 is a direct target of miR-1224-5p. |
[24] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[24] |
Representative Target(s) Regulated by This miRNA |
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|