The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-30a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccucgacuggaag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-30a could directly target RunX2 and participate in osteolysis in GCT. |
[3] |
Evidence Score (E-score) |
4 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[2] |
3 |
Reporter Assay; Western Blot |
[3] |
4 |
Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Beclin-1 (BECN1)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuaaugcuaaucgugauagggguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[5] |
2 |
Luciferase Reporter Assay; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-203a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugaaauguuuaggaccacuag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Administration of exogenous miR-203 decreased Runx2 protein levels, suggesting a functional role in controlling protein translation. |
[8] |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunoblot; In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[7] |
2 |
Luciferase Reporter Assay; Western Blot |
[8] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucccuuugucauccuaugccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-204 directly targets Runx2. |
[10] |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[9] |
2 |
Luciferase Reporter Assay; Western Blot |
[10] |
Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-205-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uccuucauuccaccggagucug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
RUNX2 was reduced after miR-205 overexpression, but increased after knockdown of miR-205 in MG63 and U2OS cells. |
[11] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[11] |
2 |
Luciferase Reporter Assay; Western Blot |
[12] |
Representative Target(s) Regulated by This miRNA |
Androgen receptor (AR)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-23b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aucacauugccagggauuaccac
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-23b function as tumor suppressor through inhibiting the upregulation of RUNX2. |
[13] |
Evidence Score (E-score) |
2 |
+ |
1 |
In Situ Hybridization; Luciferase Reporter Assay; Western Blot |
[13] |
2 |
Luciferase Reporter Assay; Western Blot |
[14] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
Carbonic anhydrase II (CA-II)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-221-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
accuggcauacaauguagauuu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
RUNX2 was a direct target of miR-221. |
[15] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[15] |
2 |
RT-PCR |
[16] |
Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1B p27Kip1 (CDKN1B)
|
Target Info
|
|
CDK inhibitor 1C p57Kip2 (CDKN1C)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-628-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucuaguaagaguggcagucga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[17] |
2 |
Luciferase Reporter Assay; Mass Spectrometry |
[18] |
Representative Target(s) Regulated by This miRNA |
Runt-related transcription factor 2 (RUNX2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-135b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uauggcuuuucauuccuauguga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[17] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IB (ACVR1B)
|
Target Info
|
|
Bone morphogenetic protein receptor (BMPR2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-195-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacagaaauauuggc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Northern Blot; Western Blot |
[19] |
Representative Target(s) Regulated by This miRNA |
ADP-ribosylation factor-like protein 2 (ARL2)
|
Target Info
|
|
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-222-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agcuacaucuggcuacugggu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Overexpression of miR-222-3p suppressed the mRNA and protein level of RUNX2 while inhibition of miR-222-3p increased the mRNA and protein level of and RUNX2. |
[20] |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[20] |
Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cuuucagucggauguuugcagc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-30a binding to the 3'untranslated region (3'UTR) region of RUNX2 inhibited the expression of RUNX2 in cancer cells. |
[21] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[21] |
Representative Target(s) Regulated by This miRNA |
Beclin-1 (BECN1)
|
Target Info
|
|
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccuacacucagcu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-30b-c bind to the 3'UTR of Runx2 to inhibit translation. |
[22] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[22] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30d-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccccgacuggaag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Autophagy-related 2B (ATG2B)
|
Target Info
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-335-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucaagagcaauaacgaaaaaugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-335 controls RUNX2 expression in hMSCs by direct binding to its 3'UTR. |
[23] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[23] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34c-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcaguguaguuagcugauugc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Ectopic expression of miR-34c reduced RUNX2 protein level while there was no decrease in RUNX2 mRNA levels. |
[24] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[24] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclin-dependent kinase 4 (CDK4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-376c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aacauagaggaaauuccacgu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunoprecipitation; Luciferase Reporter Assay; Western Blot |
[25] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Insulin-like growth factor I receptor (IGF1R)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-433-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aucaugaugggcuccucggugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
S1 and S2 sites on the 3'UTR of Runx2 may be a direct target of miR-433. |
[26] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[26] |
Representative Target(s) Regulated by This miRNA |
cAMP-dependent chloride channel (CFTR)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-497-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cagcagcacacugugguuugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Northern Blot; Western Blot |
[19] |
Representative Target(s) Regulated by This miRNA |
Angiomotin (AMOT)
|
Target Info
|
|
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|