The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Microarray; qRT-PCR |
[1] |
2 |
Microarray; qRT-PCR |
[2] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-182-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuuggcaaugguagaacucacacu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-182 directly targets TSP-1. |
[3] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
2 |
qRT-PCR |
[4] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-18a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaggugcaucuagugcagauag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-18a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target THBS1. |
[6] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[5] |
2 |
Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-let-7g-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaguaguuuguacaguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[7] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
Caspase-3 (CASP3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-19a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugugcaaaucuaugcaaaacuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-19a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target THBS1. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Adrenergic receptor beta-1 (ADRB1)
|
Target Info
|
|
Apoptosis signal-regulating kinase 1 (MAP3K5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-20a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcuuauagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Microarray |
[1] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-27b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucacaguggcuaaguucugc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Luciferase binding assay suggested that miR-27b directly targeted TSP-1. |
[8] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[8] |
Representative Target(s) Regulated by This miRNA |
Adenosine A2b receptor (ADORA2B)
|
Target Info
|
|
Albendazole monooxygenase (CYP3A4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cuuucagucggauguuugcagc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The downregulation of miR-30a-3p by Underexpression by siRNA Transfection resulted in the increased protein level of target NCOA3. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot; Polyribosome Profile Assay |
[6] |
Representative Target(s) Regulated by This miRNA |
Beclin-1 (BECN1)
|
Target Info
|
|
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-487b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaucguacagggucauccacuu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-487b targets the 3'UTR of THBS1 mRNA. |
[9] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[9] |
Representative Target(s) Regulated by This miRNA |
Metabotropic glutamate receptor 3 (mGluR3)
|
Target Info
|
|
Polycomb complex protein BMI-1 (BMI1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-98-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaguaaguuguauuguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[10] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aromatase (CYP19A1)
|
Target Info
|
|