Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T67619 Target Info
Target Name RAC-alpha serine/threonine-protein kinase (AKT1)
Synonyms RAC-PK-alpha; RAC; Proto-oncogene c-Akt; Protein kinase B alpha; PKB alpha
Target Type Successful Target
Gene Name AKT1
Biochemical Class Kinase
UniProt ID
P31749
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [1]
2 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism Both protein and mRNA expression of AKT was decreased following transfection with miR-125a-5p. [3]
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism miR-143 directly targeted akt in T24 cells. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-184 miRNA Info
miRNA Mature AC
MIMAT0000454
Sequence uggacggagaacugauaagggu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Platelet-derived growth factor B (PDGFB) Target Info
PDGFB_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-19a can promote the epithelial-mesenchymal transition through activating PI3K/AKT pathway. [10]
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [9]
2 qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Regulation Mechanism The AKT1 oncogene is a direct target of the miR-302a. [11]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [11]
2 Western Blot [12]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Regulation Mechanism miR-451 regulates Akt expression. [13]
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [13]
2 Western Blot [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-495-3p miRNA Info
miRNA Mature AC
MIMAT0002817
Sequence aaacaaacauggugcacuucuu
miRNA Species Homo sapiens
Regulation Mechanism miR-495 targeted a site in the 3'UTR of AKT1, and miR-495 levels correlated inversely with AKT1 protein level. [16]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [15]
2 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
Forkhead box protein C1 (FOXC1) Target Info
FOXC1_HUMAN
miRNA Mature ID hsa-miR-99a-5p miRNA Info
miRNA Mature AC
MIMAT0000097
Sequence aacccguagauccgaucuugug
miRNA Species Homo sapiens
Regulation Mechanism Ectopic miR-99a expression significantly suppressed the mRNA and protein levels of AKT1. [18]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [17]
2 Luciferase Reporter Assay [18]
Representative Target(s) Regulated by This miRNA Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
miRNA Mature ID hsa-miR-149-3p miRNA Info
miRNA Mature AC
MIMAT0004609
Sequence agggagggacgggggcugugc
miRNA Species Homo sapiens
Regulation Mechanism Akt1 is a direct targets of miR-149. [20]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [19]
2 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Fibroblast growth factor receptor 1 (FGFR1) Target Info
FGFR1_HUMAN
miRNA Mature ID hsa-miR-374b-5p miRNA Info
miRNA Mature AC
MIMAT0004955
Sequence auauaauacaaccugcuaagug
miRNA Species Homo sapiens
Regulation Mechanism AKT1 is a direct downstream target of miR-374b. [21]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [21]
2 Western Blot [22]
Representative Target(s) Regulated by This miRNA RAC-alpha serine/threonine-protein kinase (AKT1) Target Info
AKT1_HUMAN
Suppressor of tumorigenicity 15 protein (ST15) Target Info
RECK_HUMAN
miRNA Mature ID hsa-miR-185-3p miRNA Info
miRNA Mature AC
MIMAT0004611
Sequence aggggcuggcuuuccucugguc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; MTT [23]
2 Luciferase Reporter Assay; MTT [2]
Representative Target(s) Regulated by This miRNA RAC-alpha serine/threonine-protein kinase (AKT1) Target Info
AKT1_HUMAN
miRNA Mature ID hsa-miR-637 miRNA Info
miRNA Mature AC
MIMAT0003307
Sequence acugggggcuuucgggcucugcgu
miRNA Species Homo sapiens
Regulation Mechanism miR-637 mediated the expression of AKT1. [25]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [24]
2 Western Blot; Luciferase Reporter Assay [25]
Representative Target(s) Regulated by This miRNA RAC-alpha serine/threonine-protein kinase (AKT1) Target Info
AKT1_HUMAN
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism Dual luciferase reporter assays were performed to test the interactions of miR-100 and the targeting sequences in the AKT1 mRNA using constructs containing the predicted targeting sequences and the corresponding mutants cloned into the 3'UTR of the reporter gene. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism PI3K/Akt signal transduction was suppressed by miR-126 inhibition and evidently enhanced by miR-126 overexpression. [27]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [27]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [28]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-185-5p by mature miRNA mimics tranfection resulted in the changed mRNA level of target AKT1. [2]
Evidence Score (E-score) 1 +
1 Immunoblot; Microarray; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism miR-192-5p directly targets PI3K/AKT. [29]
Evidence Score (E-score) 1 +
1 Western Blot [29]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-196b-5p miRNA Info
miRNA Mature AC
MIMAT0001080
Sequence uagguaguuuccuguuguuggg
miRNA Species Homo sapiens
Regulation Mechanism Upregulation of miR-196b promotes the proliferation and invasion ability of gastric cancer cells by regulating the PI3K/AKT/mTOR pathway. [30]
Evidence Score (E-score) 1 +
1 Western Blot [30]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [31]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism AKT1 is a target gene of miR- 22-3p. [32]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [32]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-27a-5p miRNA Info
miRNA Mature AC
MIMAT0004501
Sequence agggcuuagcugcuugugagca
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-27a-5p resulted in decreased protein level of AKT1. [33]
Evidence Score (E-score) 1 +
1 In Situ Hybridization [33]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Gremlin-1 (Gremlin-1) Target Info
GREM1_HUMAN
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
MIMAT0000715
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Regulation Mechanism The AKT1 oncogene is a direct target of the miR-302b. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-302c-3p miRNA Info
miRNA Mature AC
MIMAT0000717
Sequence uaagugcuuccauguuucagugg
miRNA Species Homo sapiens
Regulation Mechanism The AKT1 oncogene is a direct target of the miR-302c. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-302d-3p miRNA Info
miRNA Mature AC
MIMAT0000718
Sequence uaagugcuuccauguuugagugu
miRNA Species Homo sapiens
Regulation Mechanism The AKT1 oncogene is a direct target of the miR-302d. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Erbb4 tyrosine kinase receptor (Erbb-4) Target Info
ERBB4_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism miR-340 is associated with its regulation of the AKT pathway. [34]
Evidence Score (E-score) 1 +
1 Western Blot [34]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [35]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-409-3p miRNA Info
miRNA Mature AC
MIMAT0001639
Sequence gaauguugcucggugaaccccu
miRNA Species Homo sapiens
Regulation Mechanism Inhibition of miR-409-3p by antagomiR-409-3p resulted in upregulated expression of Akt1. [36]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [36]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
Fibrinogen (FGG) Target Info
FIBG_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism miR-494-3p inhibitor prevents migration, invasion, proliferation, and promote apotosis through PTEN/AKT pathway. [37]
Evidence Score (E-score) 1 +
1 Western Blot [37]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-542-3p miRNA Info
miRNA Mature AC
MIMAT0003389
Sequence ugugacagauugauaacugaaa
miRNA Species Homo sapiens
Regulation Mechanism miR-542-3p suppresses glioblastoma cell invasion through targeting the AKT pathway by directly inhibiting AKT1. [38]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [38]
Representative Target(s) Regulated by This miRNA Angiopoietin-2 (ANGPT2) Target Info
ANGP2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-708 reduced the expression of AKT1. [39]
Evidence Score (E-score) 1 +
1 Western Blot [39]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-382-3p miRNA Info
miRNA Mature AC
MIMAT0022697
Sequence aaucauucacggacaacacuu
miRNA Species Homo sapiens
Regulation Mechanism miR-382 as a promoter for hepatocyte proliferation and cell growth via targeting PTEN-Akt axis. [40]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot; Immunostaining [40]
Representative Target(s) Regulated by This miRNA RAC-alpha serine/threonine-protein kinase (AKT1) Target Info
AKT1_HUMAN
miRNA Mature ID hsa-miR-4689 miRNA Info
miRNA Mature AC
MIMAT0019778
Sequence uugaggagacauggugggggcc
miRNA Species Homo sapiens
Regulation Mechanism Expression of the AKT1 gene was inhibited by miR-4689. [41]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [41]
Representative Target(s) Regulated by This miRNA RAC-alpha serine/threonine-protein kinase (AKT1) Target Info
AKT1_HUMAN
References  Top
REF 1 MiR-10b decreases sensitivity of glioblastoma cells to radiation by targeting AKT. J Biol Res (Thessalon). 2016 Jun 24;23:14.
REF 2 MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677.
REF 3 miR-125a inhibits the migration and invasion of liver cancer cells via suppression of the PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2015 Aug;10(2):681-686.
REF 4 Enhanced shedding of extracellular vesicles from amoeboid prostate cancer cells: potential effects on the tumor microenvironment. Cancer Biol Ther. 2014 Apr;15(4):409-18.
REF 5 Replacement treatment with microRNA-143 and -145 induces synergistic inhibition of the growth of human bladder cancer cells by regulating PI3K/Akt and MAPK signaling pathways. Cancer Lett. 2013 Jan 28;328(2):353-61.
REF 6 N( ) -Carboxymethyllysine Increases the Expression of miR-103/143 and Enhances Lipid Accumulation in 3T3-L1 Cells. J Cell Biochem. 2016 Oct;117(10):2413-22.
REF 7 Differential expression of miR-184 in temporal lobe epilepsy patients with and without hippocampal sclerosis - Influence on microglial function. Sci Rep. 2016 Sep 26;6:33943.
REF 8 MicroRNA-206 Reduces Osteosarcoma Cell Malignancy In Vitro by Targeting the PAX3-MET Axis. Yonsei Med J. 2019 Feb;60(2):163-173.
REF 9 MiR-19a promotes epithelial-mesenchymal transition through PI3K/AKT pathway in gastric cancer. World J Gastroenterol. 2015 Apr 21;21(15):4564-73.
REF 10 MiR-19a promotes epithelial-mesenchymal transition through PI3K/AKT pathway in gastric cancer. Int J Clin Exp Pathol. 2014 Sep 15;7(10):7286-96.
REF 11 The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1. RNA. 2013 Jan;19(1):85-95.
REF 12 MicroRNA-302 replacement therapy sensitizes breast cancer cells to ionizing radiation. Pharm Res. 2013 Apr;30(4):1008-16.
REF 13 MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21.
REF 14 MicroRNA-451a overexpression induces accelerated neuronal differentiation of Ntera2/D1 cells and ablation affects neurogenesis in microRNA-451a-/- ... PLoS One. 2018 Nov 21;13(11):e0207575.
REF 15 MicroRNA-495 enhances chondrocyte apoptosis, senescence and promotes the progression of osteoarthritis by targeting AKT1. Am J Transl Res. 2019 Apr 15;11(4):2232-2244.
REF 16 MiR-495 inhibits esophageal squamous cell carcinoma progression by targeting Akt1. Oncotarget. 2016 Aug 9;7(32):51223-51236.
REF 17 A dual PI3K/AKT/mTOR signaling inhibitor miR-99a suppresses endometrial carcinoma. Am J Transl Res. 2016 Feb 15;8(2):719-31.
REF 18 miR-99a suppresses the metastasis of human non-small cell lung cancer cells by targeting AKT1 signaling pathway. J Cell Biochem. 2015 Feb;116(2):268-76.
REF 19 Comprehensive analysis of microRNA-regulated protein interaction network reveals the tumor suppressive role of microRNA-149 in human hepatocellular... Mol Cancer. 2014 Nov 26;13:253.
REF 20 miR-149* induces apoptosis by inhibiting Akt1 and E2F1 in human cancer cells. Mol Carcinog. 2010 Aug;49(8):719-27.
REF 21 MicroRNA-374b Suppresses Proliferation and Promotes Apoptosis in T-cell Lymphoblastic Lymphoma by Repressing AKT1 and Wnt-16. Clin Cancer Res. 2015 Nov 1;21(21):4881-91.
REF 22 p53/microRNA-374b/AKT1 regulates colorectal cancer cell apoptosis in response to DNA damage. Int J Oncol. 2017 May;50(5):1785-1791.
REF 23 MiR-185 acts as a tumor suppressor by targeting AKT1 in non-small cell lung cancer cells. Int J Clin Exp Pathol. 2015 Sep 1;8(9):11854-62.
REF 24 MiR-637 inhibits proliferation and invasion of hepatoma cells by targeted degradation of AKT1. Eur Rev Med Pharmacol Sci. 2019 Jan;23(2):567-575.
REF 25 Decreased miRNA-637 is an unfavorable prognosis marker and promotes glioma cell growth, migration and invasion via direct targeting Akt1. Oncogene. 2015 Sep 17;34(38):4952-63.
REF 26 MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healing. PLoS One. 2013 May 28;8(5):e64434.
REF 27 MiR-126 inhibits vascular endothelial cell apoptosis through targeting PI3K/Akt signaling. Ann Hematol. 2016 Feb;95(3):365-74.
REF 28 MiR-133b regulates bladder cancer cell proliferation and apoptosis by targeting Bcl-w and Akt1. Cancer Cell Int. 2014 Jul 19;14:70.
REF 29 Curcumin inhibits cell proliferation and induces apoptosis of human non-small cell lung cancer cells through the upregulation of miR-192-5p and suppression of PI3K/Akt signaling pathway. Oncol Rep. 2015 Nov;34(5):2782-9.
REF 30 miR-196b regulates gastric cancer cell proliferation and invasion via PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2016 Mar;11(3):1745-1749.
REF 31 Skeletal Muscle myomiR Are Differentially Expressed by Endurance Exercise Mode and Combined Essential Amino Acid and Carbohydrate Supplementation. Front Physiol. 2017 Mar 23;8:182.
REF 32 The lncRNA MALAT1 protects the endothelium against ox-LDL-induced dysfunction via upregulating the expression of the miR-22-3p target genes CXCR2 and AKT. FEBS Lett. 2015 Oct 7;589(20 Pt B):3189-96.
REF 33 Coordinated targeting of the EGFR signaling axis by microRNA-27a*. Oncotarget. 2013 Sep;4(9):1388-98.
REF 34 miR-340 Inhibits Proliferation and Induces Apoptosis in Gastric Cancer Cell Line SGC-7901, Possibly via the AKT Pathway. Med Sci Monit. 2017 Jan 6;23:71-77.
REF 35 Upregulation of miR-34a by diallyl disulfide suppresses invasion and induces apoptosis in SGC-7901 cells through inhibition of the PI3K/Akt signali... Oncol Lett. 2016 Apr;11(4):2661-2667.
REF 36 miR-409-3p suppresses breast cancer cell growth and invasion by targeting Akt1. Biochem Biophys Res Commun. 2016 Jan 8;469(2):189-95.
REF 37 miR-494-3p Regulates Cellular Proliferation, Invasion, Migration, and Apoptosis by PTEN/AKT Signaling in Human Glioblastoma Cells. Cell Mol Neurobiol. 2015 Jul;35(5):679-87.
REF 38 MicroRNA-542-3p Suppresses Tumor Cell Invasion via Targeting AKT Pathway in Human Astrocytoma. J Biol Chem. 2015 Oct 9;290(41):24678-88.
REF 39 miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6.
REF 40 miR-382 targeting PTEN-Akt axis promotes liver regeneration. Oncotarget. 2016 Jan 12;7(2):1584-97.
REF 41 Concurrent Targeting of KRAS and AKT by MiR-4689 Is a Novel Treatment Against Mutant KRAS Colorectal Cancer. Mol Ther Nucleic Acids. 2015 Mar 10;4:e231.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.