The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-126-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucguaccgugaguaauaaugcg
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
7 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Luciferase Reporter Assay |
[2] |
3 |
Luciferase Reporter Assay |
[3] |
4 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[4] |
5 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[5] |
6 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[6] |
7 |
Luciferase Reporter Assay; Western Blot |
[7] |
Representative Target(s) Regulated by This miRNA |
Adrenomedullin (ADM)
|
Target Info
|
|
Angiopoietin 1 receptor (TEK)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-15a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacauaaugguuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-15a-5p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
5 |
+ |
1 |
ELISA; Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[8] |
2 |
Immunoblot; Luciferase Reporter Assay; qRT-PCR |
[9] |
3 |
Immunoblot; Luciferase Reporter Assay; qRT-PCR |
[3] |
4 |
Luciferase Reporter Assay |
[10] |
5 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[11] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-205-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uccuucauuccaccggagucug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-205-5p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
5 |
+ |
1 |
Luciferase Reporter Assay |
[12] |
2 |
Luciferase Reporter Assay |
[13] |
3 |
Luciferase Reporter Assay |
[3] |
4 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[14] |
5 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[15] |
Representative Target(s) Regulated by This miRNA |
Androgen receptor (AR)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-361-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuaucagaaucuccagggguac
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
SRIF limits VEGF release through its interaction with miR-361 indicates that miR-361 participates in the adaptive response of HUVEC to hypoxia. |
[18] |
Evidence Score (E-score) |
4 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
2 |
ELISA; Luciferase Reporter Assay; qRT-PCR |
[16] |
3 |
Luciferase Reporter Assay; Western Blot |
[17] |
4 |
qRT-PCR; Western Blot |
[18] |
Representative Target(s) Regulated by This miRNA |
C-X-C chemokine receptor type 6 (CXCR6)
|
Target Info
|
|
Signal transducer and activator of transcription 6 (STAT6)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-140-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cagugguuuuacccuaugguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-140-5p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
3 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[19] |
3 |
Luciferase Reporter Assay; Western Blot |
[20] |
Representative Target(s) Regulated by This miRNA |
Adenosine deaminase (ADA)
|
Target Info
|
|
Aspartyl aminopeptidase (DNPEP)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-200b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaauacugccugguaaugauga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Direct targets of miR-200b are VEGF and its receptors, Flt1 and KDR, which play a pivotal role in VEGF signaling. |
[22] |
Evidence Score (E-score) |
3 |
+ |
1 |
Luciferase Reporter Assay |
[21] |
2 |
Luciferase Reporter Assay; Western Blot |
[22] |
3 |
qRT-PCR; Western Blot |
[23] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
CDK inhibitor 1B p27Kip1 (CDKN1B)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
guccaguuuucccaggaaucccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-145 plays important inhibitory role in breast cancer malignancy by targeting VeGF-A, which may be potential therapeutic and diagnostic target. |
[24] |
Evidence Score (E-score) |
3 |
+ |
1 |
Immunoblot; Immunohistochemistry; Luciferase Reporter Assay; Northern Blot |
[24] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[25] |
3 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[26] |
Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-195-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacagaaauauuggc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
3 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[27] |
2 |
ELISA; Luciferase Reporter Assay |
[3] |
3 |
Luciferase Reporter Assay |
[28] |
Representative Target(s) Regulated by This miRNA |
ADP-ribosylation factor-like protein 2 (ARL2)
|
Target Info
|
|
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccaucugaaaucgguua
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
3 |
+ |
1 |
Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[29] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[30] |
3 |
PAR-CLIP |
[31] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-106b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcugacagugcagau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
2 |
Microarray |
[32] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
2 |
ELISA; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[33] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-200c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaauacugccggguaaugaugga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-200c Targets the Expression of VEGFA and Alters Cellular Proliferation. |
[35] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[34] |
2 |
Luciferase Reporter Assay; Western Blot |
[35] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-206 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggaauguaaggaagugugugg
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[36] |
2 |
PAR-CLIP |
[37] |
Representative Target(s) Regulated by This miRNA |
Annexin A2 (ANXA2)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-20a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcuuauagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
2 |
Luciferase Reporter Assay |
[38] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-20b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcucauagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
VEGFa is the direct targets of miR-20b. |
[39] |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
2 |
Luciferase Reporter Assay; Western Blot |
[39] |
Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 2 (CDK2)
|
Target Info
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcuuaucagacugauguuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
qRT-PCR |
[40] |
2 |
Western Blot; qRT-PCR |
[41] |
Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-29c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccauuugaaaucgguua
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[29] |
2 |
Sequencing; PAR-CLIP |
[31] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
B7 homolog 3 (CD276)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-378a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acuggacuuggagucagaaggc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-378 is abnormally expressed and epigenetically regulated in gastric cancer cell lines and tissues via the suppression of VEGFA , suggesting that miR-378 has tumor suppressor properties in gastric cancer. |
[42] |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
2 |
Luciferase Reporter Assay; Western Blot |
[42] |
Representative Target(s) Regulated by This miRNA |
Aromatase (CYP19A1)
|
Target Info
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-503-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcgggaacaguucugcag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[43] |
2 |
PAR-CLIP |
[31] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
CD40L receptor (CD40)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-93-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuguucgugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-93 represses VEGFA expression by targeting 3'UTR directly. |
[44] |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
2 |
Luciferase Reporter Assay; Western Blot |
[44] |
Representative Target(s) Regulated by This miRNA |
Angiogenin (ANG)
|
Target Info
|
|
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-106a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-107 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agcagcauuguacagggcuauca
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Beta-secretase 1 (BACE1)
|
Target Info
|
|
Caveolin 1 (CAV1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-125a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acaggugagguucuugggagcc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
VEGFA is a target gene of miR125a and miR125a had binding sites in the 3'UTR region of VEGF-A mRNA. |
[33] |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[33] |
Representative Target(s) Regulated by This miRNA |
Enhancer of zeste homolog 2 (EZH2)
|
Target Info
|
|
Fyn tyrosine protein kinase (FYN)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-126-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cauuauuacuuuugguacgcg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-126-5p down-regulated VEGFA expression by binding to its 3'UTR. |
[45] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[45] |
Representative Target(s) Regulated by This miRNA |
Matrix metalloproteinase-7 (MMP-7)
|
Target Info
|
|
Proto-oncogene c-Crk (c-Crk)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-134-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugugacugguugaccagagggg
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Angiopoietin-related protein 4 (ANGPTL4)
|
Target Info
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-150-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucucccaacccuuguaccagug
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Beta-arrestin-2 (ARRB2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-15b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacaucaugguuuaca
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Checkpoint kinase-1 (CHK1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-16-1-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccaguauuaacugugcugcuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[46] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
G1/S-specific cyclin-D1 (CCND1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-16-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacguaaauauuggcg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-16-5p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Corticotropin-releasing factor binding protein (CRHBP)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-17-5p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-185-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggagagaaaggcaguuccuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Vegfa is a direct target gene of miR-185 that inhibits Vegfa expression through binding to seed sequence in Vegfa 3'UTR. |
[47] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[47] |
Representative Target(s) Regulated by This miRNA |
Androgen receptor (AR)
|
Target Info
|
|
Arachidonate 12-lipoxygenase (12-LOX)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-186-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagaauucuccuuuugggcu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-186 dramatically decreased the luciferase activity of reporter plasmid with the VEGF 3'UTR. |
[9] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[9] |
Representative Target(s) Regulated by This miRNA |
Casein kinase II alpha (CSNK2A1)
|
Target Info
|
|
Fibroblast growth factor-2 (FGF2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-203a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugaaauguuuaggaccacuag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-203 suppressed cervical cancer cell proliferation and angiogenesis by targeting VEGFA. |
[48] |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[48] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-296-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agggcccccccucaauccugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[49] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-302d-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaagugcuuccauguuugagugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 2 (CDK2)
|
Target Info
|
|
Erbb4 tyrosine kinase receptor (Erbb-4)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-330-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gcaaagcacacggccugcagaga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
E2F transcription factor 1 (E2F1)
|
Target Info
|
|
Extracellular matrix receptor III (CD44)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcagugucuuagcugguugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-34a-5p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Androgen receptor (AR)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaucacuaacuccacugccau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaggcagugucauuagcugauug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-34b-5p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Beta-catenin (CTNNB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-372-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaagugcugcgacauuugagcgu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-372-3p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
ATPase family AAA domain containing 2 (ATAD2)
|
Target Info
|
|
B-cell translocation gene 1 protein (BTG1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-373-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gaagugcuucgauuuuggggugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
B-cell translocation gene 1 protein (BTG1)
|
Target Info
|
|
Cell surface protein HB15 (CD83)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-383-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agaucagaaggugauuguggcu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
G1/S-specific cyclin-D1 (CCND1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-429 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaauacugucugguaaaaccgu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR429 decreased the 3'UTR luciferase activity of vascular endothelial growth factor (VEGF). |
[50] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[50] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
DNA [cytosine-5]-methyltransferase 1 (DNMT1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-504-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agacccuggucugcacucuauc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-504-5p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-205-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gauuucaguggagugaaguuc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-205 directly binds VEGFA mRNA 3'UTR and miR-205 levels are negatively correlated with VEGFA mRNA expression in breast cancer patients. |
[51] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[51] |
Representative Target(s) Regulated by This miRNA |
Fibroblast growth factor-2 (FGF2)
|
Target Info
|
|
Vascular endothelial growth factor A (VEGFA)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-374b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
auauaauacaaccugcuaagug
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
PAR-CLIP |
[52] |
Representative Target(s) Regulated by This miRNA |
RAC-alpha serine/threonine-protein kinase (AKT1)
|
Target Info
|
|
Suppressor of tumorigenicity 15 protein (ST15)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-520g-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acaaagugcuucccuuuagagugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-520g-3p by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Matrix metalloproteinase-2 (MMP-2)
|
Target Info
|
|
Vascular endothelial growth factor A (VEGFA)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-520h |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acaaagugcuucccuuuagagu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-520h by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
Histone deacetylase 1 (HDAC1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-718 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cuuccgccccgccgggcgucg
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[53] |
Representative Target(s) Regulated by This miRNA |
Phosphatase and tensin homolog (PTEN)
|
Target Info
|
|
Vascular endothelial growth factor A (VEGFA)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-942-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cacauggccgaaacagagaagu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[54] |
Representative Target(s) Regulated by This miRNA |
Matrix metalloproteinase-9 (MMP-9)
|
Target Info
|
|
Vascular endothelial growth factor A (VEGFA)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-147a |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
guguguggaaaugcuucugc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-147a by siRNA transfection resulted in the decreased protein level of target VEGFA. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Vascular endothelial growth factor A (VEGFA)
|
Target Info
|
|