Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T89361 Target Info
Target Name Cyclin-dependent kinase 6 (CDK6)
Synonyms Serine/threonine-protein kinase PLSTIRE; Serine/threonine protein kinase PLSTIRE; Cell division protein kinase 6; CDKN6
Target Type Successful Target
Gene Name CDK6
Biochemical Class Kinase
UniProt ID
Q00534
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 8 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; Western Blot; Microarray [3]
4 qRT-PCR; Luciferase Reporter Assay; Western Blot [4]
5 qRT-PCR; Western Blot [5]
6 qRT-PCR; Western Blot; Luciferase Reporter Assay [6]
7 Western Blot [7]
8 Western Blot [8]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-107 by mature miRNA mimics tranfection resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 7 +
1 Immunoblot; Microarray; qRT-PCR; Western Blot [9]
2 Luciferase Reporter Assay; Microarray; Western Blot; qRT-PCR [10]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
4 Western Blot [12]
5 Western Blot [13]
6 Western Blot [8]
7 Western Blot; qRT-PCR [14]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29a-3p resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 6 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [15]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [16]
3 Luciferase Reporter Assay; Western Blot [17]
4 qRT-PCR; Western Blot [18]
5 qRT-PCR; Western Blot [19]
6 qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with the antagomir inhibitor of miR-449a resulted in induction of both CDK6 protein levels. [23]
Evidence Score (E-score) 4 +
1 ChIP; Immunohistochemistry; Immunoprecipitation; qRT-PCR; Western Blot [20]
2 Immunofluorescence; qRT-PCR; Western Blot [21]
3 Luciferase Reporter Assay [22]
4 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-195-5p resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [24]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
3 Reporter Assay; Western Blot; qRT-PCR [25]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7b-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; Western Blot [26]
2 Luciferase Reporter Assay; Microarray; Western Blot [8]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-124-3p miRNA Info
miRNA Mature AC
MIMAT0000422
Sequence uaaggcacgcggugaaugcc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-124-3p by 5-Aza-Deoxycytidine induced demethylation resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 2 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [8]
2 Western Blott; Luciferase Reporter Assay [27]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism Introducing miR-145 into SKOV3/PTX and A2780/PTX cells led to a reduction in Cdk6 and Sp1 along with downregulation of P-gp and pRb. [29]
Evidence Score (E-score) 2 +
1 ChIP; Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [28]
2 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [29]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-185-5p by mature miRNA mimics tranfection resulted in the changed mRNA level of target CDK6. [8]
Evidence Score (E-score) 2 +
1 Immunoblot; Microarray; qRT-PCR; Western Blot [9]
2 Immunoblot; Microarray; qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism miR-203 exert cell growth-inhibitory effect with the downregulation of their potential target of CDK6. [27]
Evidence Score (E-score) 2 +
1 Immunoprecipitation; qRT-PCR; Western Blot [30]
2 Luciferase Reporter Assay; Western Blot [27]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [31]
2 PAR-CLIP [32]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism CDK6 was the target of miR-424. [33]
Evidence Score (E-score) 2 +
1 PAR-CLIP [33]
2 qRT-PCR; Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-491-3p miRNA Info
miRNA Mature AC
MIMAT0004765
Sequence cuuaugcaagauucccuucuac
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [35]
2 PAR-CLIP [32]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
Insulin-like growth factor-binding protein 2 (IGFBP2) Target Info
IBP2_HUMAN
miRNA Mature ID hsa-miR-125b-5p miRNA Info
miRNA Mature AC
MIMAT0000423
Sequence ucccugagacccuaacuuguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-125b-5p resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 1 +
1 Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-191-5p miRNA Info
miRNA Mature AC
MIMAT0000440
Sequence caacggaaucccaaaagcagcug
miRNA Species Homo sapiens
Regulation Mechanism CDK6 expression is downregulated in senescent HEKn cells and its 3'UTR are direct miR-191 targets. [36]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [36]
Representative Target(s) Regulated by This miRNA CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism CDK6 is a direct target of miR200a. [37]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [37]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-203a-5p miRNA Info
miRNA Mature AC
MIMAT0031890
Sequence agugguucuuaacaguucaacaguu
miRNA Species Homo sapiens
Regulation Mechanism miR203 overexpression decreased cell-cycle activator CDK6. [38]
Evidence Score (E-score) 1 +
1 Western Blot [38]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
MIMAT0001413
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-20b overexpression inhibits the expression of CDK6. [39]
Evidence Score (E-score) 1 +
1 Immunoblot; Immunoprecipitation [39]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-21-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CDK6; The Underexpression by LNA Antisense miRNA Oligonucleotides resulted in the changed mRNA level of target CDK6. [8]
Evidence Score (E-score) 1 +
1 Western Blot; Microarray; Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism miR-211 targets CDK6 by binding its 3'UTR. [40]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [40]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
miRNA Mature ID hsa-miR-214-5p miRNA Info
miRNA Mature AC
MIMAT0004564
Sequence ugccugucuacacuugcugugc
miRNA Species Homo sapiens
Regulation Mechanism Suppression of CDK6 was functionally important for the biological effects of miR-214. miR-214 directly inhibited CDK6 cell-cycle regulators. [41]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [41]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclin-dependent kinase 3 (CDK3) Target Info
CDK3_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [42]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-29b-3p miRNA Info
miRNA Mature AC
MIMAT0000100
Sequence uagcaccauuugaaaucaguguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29b-3p resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism CDK6 is a direct target of miR-29. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-30a-3p miRNA Info
miRNA Mature AC
MIMAT0000088
Sequence cuuucagucggauguuugcagc
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-30a-3p by siRNA Transfection resulted in the increased protein level of target CDK6. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot; Polyribosome Profile Assay [8]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism Re-introducing CDK6 significantly rescues cells from the suppression of cell proliferation and cell cycle arrest mediated by miR-340. [43]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [43]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-34a-3p miRNA Info
miRNA Mature AC
MIMAT0004557
Sequence caaucagcaaguauacugcccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [44]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Regulation Mechanism miR-34b transfection decreased CDK6 protein levels. [45]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [45]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Regulation Mechanism CDK6 is inhibited by miR-34 at the translational level. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-378a-3p miRNA Info
miRNA Mature AC
MIMAT0000732
Sequence acuggacuuggagucagaaggc
miRNA Species Homo sapiens
Regulation Mechanism miR-378 are abnormally expressed and epigenetically regulated in gastric cancer cell lines and tissues via the suppression of CDK6. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Aromatase (CYP19A1) Target Info
CP19A_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-449b-5p miRNA Info
miRNA Mature AC
MIMAT0003327
Sequence aggcaguguauuguuagcuggc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-491-5p miRNA Info
miRNA Mature AC
MIMAT0002807
Sequence aguggggaacccuuccaugagg
miRNA Species Homo sapiens
Regulation Mechanism miR-491-3p regulates CDK6 by directly targeting the its 3'UTR. [35]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [35]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism miR-494 directly interacts with the 3'UTR of CDK6 and results in a decrease of CDK6 at protein level. [46]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [46]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-504-5p miRNA Info
miRNA Mature AC
MIMAT0002875
Sequence agacccuggucugcacucuauc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [47]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-506-3p miRNA Info
miRNA Mature AC
MIMAT0002878
Sequence uaaggcacccuucugaguaga
miRNA Species Homo sapiens
Regulation Mechanism CDK6 is a direct target of miR-506, and that miR-506 can inhibit CDK4/6-FOXM1 signalling, which is activated in the majority of serous ovarian carcinomas. [48]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [48]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-892b miRNA Info
miRNA Mature AC
MIMAT0004918
Sequence cacuggcuccuuucuggguaga
miRNA Species Homo sapiens
Regulation Mechanism The expression of CDK6 were significantly reduced in miR-892b transfectants. [49]
Evidence Score (E-score) 1 +
1 Immunoblot [49]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-129-2-3p miRNA Info
miRNA Mature AC
MIMAT0004605
Sequence aagcccuuaccccaaaaagcau
miRNA Species Homo sapiens
Regulation Mechanism Increased miR-129 levels in gastric cancer cells resulted in significant G0/G1 phase arrest/cyclin dependent kinase 6 (CDK6), a cell cycle associated protein involved in G1-S transition, and CDK6 was a target of mIR-129. [50]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [50]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-137-3p miRNA Info
miRNA Mature AC
MIMAT0000429
Sequence uuauugcuuaagaauacgcguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-137-3p by mature miRNA precursor transfection resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
Kruppel like factor 4 (KLF4) Target Info
KLF4_HUMAN
miRNA Mature ID hsa-miR-195-3p miRNA Info
miRNA Mature AC
MIMAT0004615
Sequence ccaauauuggcugugcugcucc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [51]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
miRNA Mature ID hsa-miR-129-5p miRNA Info
miRNA Mature AC
MIMAT0000242
Sequence cuuuuugcggucugggcuugc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-129-5p resulted in the decreased protein level of target CDK6. [8]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
References  Top
REF 1 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 2 MicroRNA-34a inhibits glioblastoma growth by targeting multiple oncogenes. Cancer Res. 2009 Oct 1;69(19):7569-76.
REF 3 microRNAs join the p53 network--another piece in the tumour-suppression puzzle. Nat Rev Cancer. 2007 Nov;7(11):819-22.
REF 4 Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. FEBS Lett. 2008 Apr 30;582(10):1564-8.
REF 5 Synthetic miR-34a mimics as a novel therapeutic agent for multiple myeloma: in vitro and in vivo evidence. Clin Cancer Res. 2012 Nov 15;18(22):6260-70.
REF 6 miR-34a contributes to megakaryocytic differentiation of K562 cells independently of p53. Blood. 2009 Sep 3;114(10):2181-92.
REF 7 The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nat Med. 2011 Feb;17(2):211-5.
REF 8 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 9 MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677.
REF 10 p53 activates the PANK1/miRNA-107 gene leading to downregulation of CDK6 and p130 cell cycle proteins. Nucleic Acids Res. 2011 Jan;39(2):440-53.
REF 11 miR-107 functions as a tumor suppressor in human esophageal squamous cell carcinoma and targets Cdc42. Oncol Rep. 2017 May;37(5):3116-3127.
REF 12 P53-induced microRNA-107 inhibits proliferation of glioma cells and down-regulates the expression of CDK6 and Notch-2. Neurosci Lett. 2013 Feb 8;534:327-32.
REF 13 Epigenetic silencing of MicroRNA miR-107 regulates cyclin-dependent kinase 6 expression in pancreatic cancer. Pancreatology. 2009;9(3):293-301.
REF 14 miR-107 targets cyclin-dependent kinase 6 expression, induces cell cycle G1 arrest and inhibits invasion in gastric cancer cells. Med Oncol. 2012 Jun;29(2):856-63.
REF 15 Interferon--induced activation of Signal Transducer and Activator of Transcription 1 (STAT1) up-regulates the tumor suppressing microRNA-29 family in melanoma cells. Cell Commun Signal. 2012 Dec 17;10(1):41.
REF 16 microRNA expression profile and identification of miR-29 as a prognostic marker and pathogenetic factor by targeting CDK6 in mantle cell lymphoma. Blood. 2010 Apr 1;115(13):2630-9.
REF 17 MicroRNA-29a and microRNA-142-3p are regulators of myeloid differentiation and acute myeloid leukemia. Blood. 2012 May 24;119(21):4992-5004.
REF 18 Reduced miR-29a-3p expression is linked to the cell proliferation and cell migration in gastric cancer. World J Surg Oncol. 2015 Mar 12;13:101.
REF 19 MicroRNA 29b functions in acute myeloid leukemia. Blood. 2009 Dec 17;114(26):5331-41.
REF 20 Long noncoding RNA ANRIL indicates a poor prognosis of gastric cancer and promotes tumor growth by epigenetically silencing of miR-99a/miR-449a. Oncotarget. 2014 Apr 30;5(8):2276-92.
REF 21 miR-449a and CDK6 in gastric carcinoma. Oncol Lett. 2014 Oct;8(4):1533-1538.
REF 22 microRNA-449a functions as a tumor suppressor in neuroblastoma through inducing cell differentiation and cell cycle arrest. RNA Biol. 2015;12(5):538-54.
REF 23 miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A. Genes Dev. 2009 Oct 15;23(20):2388-93.
REF 24 MicroRNA-195 and microRNA-378 mediate tumor growth suppression by epigenetical regulation in gastric cancer. Gene. 2013 Apr 15;518(2):351-9.
REF 25 MicroRNA-195 suppresses tumorigenicity and regulates G1/S transition of human hepatocellular carcinoma cells. Hepatology. 2009 Jul;50(1):113-21.
REF 26 The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22.
REF 27 miR-124 and miR-203 are epigenetically silenced tumor-suppressive microRNAs in hepatocellular carcinoma. Carcinogenesis. 2010 May;31(5):766-76.
REF 28 miR-145 mediates the antiproliferative and gene regulatory effects of vitamin D3 by directly targeting E2F3 in gastric cancer cells. Oncotarget. 2015 Apr 10;6(10):7675-85.
REF 29 miR-145 sensitizes ovarian cancer cells to paclitaxel by targeting Sp1 and Cdk6. Int J Cancer. 2014 Sep 15;135(6):1286-96.
REF 30 ING1b-inducible microRNA203 inhibits cell proliferation. Br J Cancer. 2013 Mar 19;108(5):1143-8.
REF 31 miRNA-214 is related to invasiveness of human non-small cell lung cancer and directly regulates alpha protein kinase 2 expression. Genes Chromosomes Cancer. 2013 Oct;52(10):895-911.
REF 32 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 33 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
REF 34 miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404.
REF 35 Two mature products of MIR-491 coordinate to suppress key cancer hallmarks in glioblastoma. Oncogene. 2015 Mar 26;34(13):1619-1628.
REF 36 MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation. Biochem Biophys Res Commun. 2012 Jul 6;423(3):509-14.
REF 37 microRNA-200a is an independent prognostic factor of hepatocellular carcinoma and induces cell cycle arrest by targeting CDK6. Oncol Rep. 2013 Nov;30(5):2203-10.
REF 38 MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42.
REF 39 MicroRNA-20b inhibits the proliferation, migration and invasion of bladder cancer EJells via the targeting of cellycle regulation and Sp-1-mediated MMP-2 expression. Oncol Rep. 2015 Sep;34(3):1605-12.
REF 40 miR-211 suppresses epithelial ovarian cancer proliferation and cell-cycle progression by targeting Cyclin D1 and CDK6. Mol Cancer. 2015 Mar 11;14:57.
REF 41 miR-214/199a/199a* cluster levels predict poor survival in hepatocellular carcinoma through interference with cell-cycle regulators. Oncotarget. 2016 Jan 5;7(1):929-45.
REF 42 MicroRNA-26a/b and their host genes cooperate to inhibit the G1/S transition by activating the pRb protein. Nucleic Acids Res. 2012 May;40(10):4615-25.
REF 43 miR-340 inhibits glioblastoma cell proliferation by suppressing CDK6, cyclin-D1 and cyclin-D2. Biochem Biophys Res Commun. 2015 May 8;460(3):670-7.
REF 44 Expression of transforming growth factor 1 promotes cholangiocarcinoma development and progression. Cancer Lett. 2016 Sep 28;380(1):153-62.
REF 45 A microRNA DNA methylation signature for human cancer metastasis. Proc Natl Acad Sci U S A. 2008 Sep 9;105(36):13556-61.
REF 46 MicroRNA down-regulated in human cholangiocarcinoma control cell cycle through multiple targets involved in the G1/S checkpoint. Hepatology. 2011 Dec;54(6):2089-98.
REF 47 microRNA-504 inhibits cancer cell proliferation via targeting CDK6 in hypopharyngeal squamous cell carcinoma. Int J Oncol. 2014 Jun;44(6):2085-92.
REF 48 MiR-506 suppresses proliferation and induces senescence by directly targeting the CDK4/6-FOXM1 axis in ovarian cancer. J Pathol. 2014 Jul;233(3):308-18.
REF 49 MicroRNA-892b influences proliferation, migration and invasion of bladder cancer cells by mediating the p19ARF/cyclin D1/CDK6 and Sp-1/MMP-9 pathways. Oncol Rep. 2016 Oct;36(4):2313-20.
REF 50 Growth inhibitory effects of three miR-129 family members on gastric cancer. Gene. 2013 Dec 10;532(1):87-93.
REF 51 Identification of Host Micro RNAs That Differentiate HIV-1 and HIV-2 Infection Using Genome Expression Profiling Techniques. Viruses. 2016 May 2;8(5). pii: E121.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.